Class Solution


  • public class Solution
    extends Object
    187 - Repeated DNA Sequences.

    Medium

    The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

    • For example, "ACGAATTCCG" is a DNA sequence.

    When studying DNA , it is useful to identify repeated sequences within the DNA.

    Given a string s that represents a DNA sequence , return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

    Example 1:

    Input: s = “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”

    Output: [“AAAAACCCCC”,“CCCCCAAAAA”]

    Example 2:

    Input: s = “AAAAAAAAAAAAA”

    Output: [“AAAAAAAAAA”]

    Constraints:

    • 1 <= s.length <= 105
    • s[i] is either 'A', 'C', 'G', or 'T'.
    • Constructor Detail

      • Solution

        public Solution()
    • Method Detail

      • findRepeatedDnaSequences

        public List<String> findRepeatedDnaSequences​(String s)