Package g0101_0200.s0187_repeated_dna_sequences

Class Solution

java.lang.Object

g0101_0200.s0187_repeated_dna_sequences.Solution

public class Solution
extends Object

187 - Repeated DNA Sequences\. Medium The **DNA sequence** is composed of a series of nucleotides abbreviated as `'A'`, `'C'`, `'G'`, and `'T'`. * For example, `"ACGAATTCCG"` is a **DNA sequence**. When studying **DNA** , it is useful to identify repeated sequences within the DNA. Given a string `s` that represents a **DNA sequence** , return all the **`10`\-letter-long** sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in **any order**. **Example 1:** **Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" **Output:** ["AAAAACCCCC","CCCCCAAAAA"] **Example 2:** **Input:** s = "AAAAAAAAAAAAA" **Output:** ["AAAAAAAAAA"] **Constraints:** * 1 <= s.length <= 105 * `s[i]` is either `'A'`, `'C'`, `'G'`, or `'T'`.

Constructor Summary

Constructors

Constructor	Description
Solution()

Method Summary

Modifier and Type	Method	Description
List<String>	findRepeatedDnaSequences(String s)

Methods inherited from class java.lang.Object

clone, equals, finalize, getClass, hashCode, notify, notifyAll, toString, wait, wait, wait

Constructor Details

Solution

public Solution()

Method Details

findRepeatedDnaSequences

public List<String> findRepeatedDnaSequences(String s)