Package g0101_0200.s0187_repeated_dna_sequences

Class Solution

java.lang.Object

g0101_0200.s0187_repeated_dna_sequences.Solution

public class Solution
extends Object

187 - Repeated DNA Sequences.<p>Medium</p> <p>The <strong>DNA sequence</strong> is composed of a series of nucleotides abbreviated as <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, and <code>'T'</code>.</p> <ul> <li>For example, <code>&quot;ACGAATTCCG&quot;</code> is a <strong>DNA sequence</strong>.</li> </ul> <p>When studying <strong>DNA</strong> , it is useful to identify repeated sequences within the DNA.</p> <p>Given a string <code>s</code> that represents a <strong>DNA sequence</strong> , return all the <strong><code>10</code>-letter-long</strong> sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in <strong>any order</strong>.</p> <p><strong>Example 1:</strong></p> <p><strong>Input:</strong> s = &ldquo;AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT&rdquo;</p> <p><strong>Output:</strong> [&ldquo;AAAAACCCCC&rdquo;,&ldquo;CCCCCAAAAA&rdquo;]</p> <p><strong>Example 2:</strong></p> <p><strong>Input:</strong> s = &ldquo;AAAAAAAAAAAAA&rdquo;</p> <p><strong>Output:</strong> [&ldquo;AAAAAAAAAA&rdquo;]</p> <p><strong>Constraints:</strong></p> <ul> <li><code>1 <= s.length <= 10⁵</code></li> <li><code>s[i]</code> is either <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, or <code>'T'</code>.</li> </ul>

Constructor Summary

Constructors

Constructor	Description
Solution()

Method Summary

Modifier and Type	Method	Description
List<String>	findRepeatedDnaSequences(String s)

Methods inherited from class java.lang.Object

clone, equals, finalize, getClass, hashCode, notify, notifyAll, toString, wait, wait, wait

Constructor Details

Solution

public Solution()

Method Details

findRepeatedDnaSequences

public List<String> findRepeatedDnaSequences(String s)